Sequence ID | >WENV170719194 |
Genome ID | LSQX01104951 |
Phylum/Class | [LSQX] anaerobic digester metagenome; 4 biogas reactors fed with cattle manure at either 37C or 55C with and without the addition |
Species | |
Start position on genome | 273495 |
End posion on genome | 273569 |
Amino Acid | Ala |
Anticodon | CGC |
Upstream region at tRNA start position |
ttgatcatgt |
tRNA gene sequence |
GGGGCTGTAGCGCAGGGGGAGCGCGCTTCCTTCGCACGGAAGAGGCCGGGGGTTCAAATC |
Downstream region at tRNA end position |
gtgcttaaac |
Secondary structure (Cloverleaf model) | >WENV170719194 Ala CGC t ACCA gtgcttaaac G - C G - C G + T G - C C - G T - A G - C T A T C C C C C A G A A | | | | | A G C G C G G G G G G C G | | | | T T G G C G C G A G AGGCC C - G T - A T - A C - G C - G T C T A C G C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |