Sequence ID | >WENV170719197 |
Genome ID | LSQX01104951 |
Phylum/Class | [LSQX] anaerobic digester metagenome; 4 biogas reactors fed with cattle manure at either 37C or 55C with and without the addition |
Species | |
Start position on genome | 277285 |
End posion on genome | 277360 |
Amino Acid | Lys |
Anticodon | CTT |
Upstream region at tRNA start position |
tgtttatcgt |
tRNA gene sequence |
GGACCGTTAGCTCAATCGGCAGAGCACCTGACTCTTAATCAGGGGGTTACAGGTTCGATT |
Downstream region at tRNA end position |
tttcatgcct |
Secondary structure (Cloverleaf model) | >WENV170719197 Lys CTT t ACCA tttcatgcct G - C G - C A - T C - G C - G G - C T - A T T T T G T C C A T A A A | | | | | G C C T C G A C A G G C G | | | | T T G G A G C C A A GGGTT C - G C - G T - A G - C A - T C A T A C T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |