Sequence ID | >WENV170719198 |
Genome ID | LSQX01104951 |
Phylum/Class | [LSQX] anaerobic digester metagenome; 4 biogas reactors fed with cattle manure at either 37C or 55C with and without the addition |
Species | |
Start position on genome | 282542 |
End posion on genome | 282626 |
Amino Acid | Leu |
Anticodon | TAG |
Upstream region at tRNA start position |
ttcaatatgt |
tRNA gene sequence |
GCGAGAGTGGCGGAATTGGTATACGCGCTGGACTTAGGATCCAGTGGTTTCGGCCGTAGG |
Downstream region at tRNA end position |
tttcatttct |
Secondary structure (Cloverleaf model) | >WENV170719198 Leu TAG t ACCA tttcatttct G - C C - G G - C A - T G - C A - T G - C T G T T C C C C A T A A G | | | | | G T G G C G A G G G G C G | | | T T G A C G C T A T G TGGTTTCGGCCGT C - G T - A G - C G - C A - T C A T G T A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |