Sequence ID | >WENV170719242 |
Genome ID | LSQX01106982 |
Phylum/Class | [LSQX] anaerobic digester metagenome; 4 biogas reactors fed with cattle manure at either 37C or 55C with and without the addition |
Species | |
Start position on genome | 114993 |
End posion on genome | 114920 |
Amino Acid | Val |
Anticodon | CAC |
Upstream region at tRNA start position |
tcagcaacac |
tRNA gene sequence |
GGGCTCATGGTCTAGTGGTTATGACGTCTCCCTCACACGGAGGAGGTCGCCGGTTCGAAT |
Downstream region at tRNA end position |
ctcttttgcc |
Secondary structure (Cloverleaf model) | >WENV170719242 Val CAC c ACtt ctcttttgcc G - C G - C G - C C - G T - A C - G A - T T A T C G G C C A T G A G | | | | | G G T C T G G C C G G C G | | | T T T T G A C T A G AGGTC T + G C - G T - A C - G C - G C C T A C A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |