Sequence ID | >WENV170719291 |
Genome ID | LSQX01109080 |
Phylum/Class | [LSQX] anaerobic digester metagenome; 4 biogas reactors fed with cattle manure at either 37C or 55C with and without the addition |
Species | |
Start position on genome | 6244 |
End posion on genome | 6332 |
Amino Acid | Ser |
Anticodon | GCT |
Upstream region at tRNA start position |
tttttcagtT |
tRNA gene sequence |
GGAGAGGTGCGAGAGTGGCCGAATCGGGCTCCCTGCTAAGGAGTTGACCTGGTAACGGGT |
Downstream region at tRNA end position |
tttttacaat |
Secondary structure (Cloverleaf model) | >WENV170719291 Ser GCT T GGat tttttacaat G - C G - C A - T G - C A - T G - C G - C T A T C C C C C A T G A G | | | | | G G G A G C G G G G G C G | | | T T C A T C G C G A G TGACCTGGTAACGGGTCC G + T C - G T - A C - G C - G C A T A G C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |