Sequence ID | >WENV170719323 |
Genome ID | LSQX01110870 |
Phylum/Class | [LSQX] anaerobic digester metagenome; 4 biogas reactors fed with cattle manure at either 37C or 55C with and without the addition |
Species | |
Start position on genome | 33005 |
End posion on genome | 32931 |
Amino Acid | Gly |
Anticodon | CCC |
Upstream region at tRNA start position |
tcttccctga |
tRNA gene sequence |
GCGGGCGTAATTCAGTGGTAGAATGTCAGCTTCCCAAGCTGGACGTCGCCGGTTCGAGCC |
Downstream region at tRNA end position |
tttgccgtaa |
Secondary structure (Cloverleaf model) | >WENV170719323 Gly CCC a TCCA tttgccgtaa G - C C - G G - C G - C G - C C - G G - C C G T T G G C C A G A A + | | | | G T C T T A G C C G G C G | | | | T T G G A A T T A G ACGTC T + G C - G A - T G - C C - G T A T A C C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |