Sequence ID | >WENV170719418 |
Genome ID | LSQX01113772 |
Phylum/Class | [LSQX] anaerobic digester metagenome; 4 biogas reactors fed with cattle manure at either 37C or 55C with and without the addition |
Species | |
Start position on genome | 11429 |
End posion on genome | 11354 |
Amino Acid | Asn |
Anticodon | GTT |
Upstream region at tRNA start position |
ccaacaatat |
tRNA gene sequence |
TCCTCCTTAGCTCAGCTGGTAGAGCATGCGGCTGTTAACCGCAGGGTCGTAGGTTCGAGT |
Downstream region at tRNA end position |
gctggtacct |
Secondary structure (Cloverleaf model) | >WENV170719418 Asn GTT t GCCA gctggtacct T - A C - G C - G T - A C - G C T T T T G T C A T C C A C G A A | | | | | G T C T C G G T A G G C G | | | | T T G G A G C T A A GGGTC T - A G - C C - G G - C G - C C A T A G T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |