Sequence ID | >WENV170719435 |
Genome ID | LSQX01114497 |
Phylum/Class | [LSQX] anaerobic digester metagenome; 4 biogas reactors fed with cattle manure at either 37C or 55C with and without the addition |
Species | |
Start position on genome | 1885 |
End posion on genome | 1801 |
Amino Acid | Tyr |
Anticodon | GTA |
Upstream region at tRNA start position |
atcttaatat |
tRNA gene sequence |
GGAGGGGTTCCCGAGTGGCCAAAGGGGGCAGACTGTAAATCTGCTGGCACAGCCTTCGAT |
Downstream region at tRNA end position |
ttctgctttt |
Secondary structure (Cloverleaf model) | >WENV170719435 Tyr GTA t ACCA ttctgctttt G - C G - C A - T G - C G - C G - C G + T T A T C T A C C A T G A T | | | | | G G G C C C G A T G G C G | | | T T C A G G G C A A G TGGCACAGCCTTC G - C C - G A - T G - C A - T C A T A G T A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |