Sequence ID | >WENV170719596 |
Genome ID | LSQX01119824 |
Phylum/Class | [LSQX] anaerobic digester metagenome; 4 biogas reactors fed with cattle manure at either 37C or 55C with and without the addition |
Species | |
Start position on genome | 191 |
End posion on genome | 106 |
Amino Acid | Leu |
Anticodon | TAA |
Upstream region at tRNA start position |
acttctgttt |
tRNA gene sequence |
GCCGGGATGGCGGAATGGTAGACGCACGGGACTTAAAATCCTGCGAACGCAAGTTCGTGC |
Downstream region at tRNA end position |
gaaacacacc |
Secondary structure (Cloverleaf model) | >WENV170719596 Leu TAA t ACCA gaaacacacc G - C C - G C - G G - C G + T G - C A - T T A T C G C C C A T A A G | | | | | G G G G C G G C G G G C G | | | T T T A C G C A G A CGAACGCAAGTTCGT C - G G + T G - C G - C A - T C A T A T A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |