Sequence ID | >WENV170719666 |
Genome ID | LSQX01122381 |
Phylum/Class | [LSQX] anaerobic digester metagenome; 4 biogas reactors fed with cattle manure at either 37C or 55C with and without the addition |
Species | |
Start position on genome | 13394 |
End posion on genome | 13487 |
Amino Acid | Ser |
Anticodon | GGA |
Upstream region at tRNA start position |
tgcaccgcgc |
tRNA gene sequence |
GGAGTGGTGTCCGAGTTGGCTTAAGGAGCACGACTGGAAATCGTGTAGGCGGGGGTAACT |
Downstream region at tRNA end position |
ctcgacccgg |
Secondary structure (Cloverleaf model) | >WENV170719666 Ser GGA c GCCA ctcgacccgg G - C G - C A - T G - C T - A G - C G - C T A T C T C C C A T T G A G | | | | | G G G C C T G A G G G C G | | | T T C A G G A T T A G TAGGCGGGGGTAACTCGTCTC C - G A - T C - G G - C A - T C A T A G G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |