Sequence ID | >WENV170719808 |
Genome ID | LSQX01129623 |
Phylum/Class | [LSQX] anaerobic digester metagenome; 4 biogas reactors fed with cattle manure at either 37C or 55C with and without the addition |
Species | |
Start position on genome | 12638 |
End posion on genome | 12710 |
Amino Acid | Val |
Anticodon | CAC |
Upstream region at tRNA start position |
ctttttgtat |
tRNA gene sequence |
GGATTCGTGGTCTAGTGGTATGACGTCGCCTTCACACGGCGAAGGTCAGGAGTTCGAATC |
Downstream region at tRNA end position |
ttttttggtt |
Secondary structure (Cloverleaf model) | >WENV170719808 Val CAC t ACtg ttttttggtt G - C G - C A - T T - A T + G C - G G - C T A T T C C T C A G A G | | | | | G T T C T G A G G A G C G | | | T T G T G A C T A G AGGTC T - A C - G G - C C - G C - G T C T A C A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |