Sequence ID | >WENV170719851 |
Genome ID | LSQX01131132 |
Phylum/Class | [LSQX] anaerobic digester metagenome; 4 biogas reactors fed with cattle manure at either 37C or 55C with and without the addition |
Species | |
Start position on genome | 105725 |
End posion on genome | 105809 |
Amino Acid | Leu |
Anticodon | CAG |
Upstream region at tRNA start position |
agtcagtcaa |
tRNA gene sequence |
GCAGGGGTAGCCAAGCCTGGCCAACGGCGTAGGATTCAGGGTCCTATCCTTAGTGGTTCG |
Downstream region at tRNA end position |
ctcttctcac |
Secondary structure (Cloverleaf model) | >WENV170719851 Leu CAG a ACtt ctcttctcac G - C C - G A - T G - C G - C G - C G - C T A T T T C C C A C C G A A + + | | | A T A C C G G G G G G C G | | | T T G C G G C C C A A G TCCTTAGTGGTTC T - A A - T G - C G - C A - T T G T G C A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |