Sequence ID | >WENV170719852 |
Genome ID | LSQX01131132 |
Search identical group | |
Phylum/Class | [LSQX] anaerobic digester metagenome; 4 biogas reactors fed with cattle manure at either 37C or 55C with and without the addition |
Species | |
Start position on genome | 131380 |
End posion on genome | 131455 |
Amino Acid | Glu |
Anticodon | TTC |
Upstream region at tRNA start position |
cctgccaaac |
tRNA gene sequence |
GCTCCCGTAGTGTAGTCCGGTCAATCATTCGGGCCTTTCGAGCCCGCCACCCGGGTTCAA |
Downstream region at tRNA end position |
ctcttccacc |
Secondary structure (Cloverleaf model) | >WENV170719852 Glu TTC c ACtt ctcttccacc G - C C - G T - A C - G C - G C - G G - C T A T G G C C C A C T G A A | | | | | A C T G T G C C G G G C G | | + T T G T C A T T C A A T CCAC C - G G - C G - C G - C C - G C A T G T T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |