Sequence ID | >WENV170719853 |
Genome ID | LSQX01131132 |
Phylum/Class | [LSQX] anaerobic digester metagenome; 4 biogas reactors fed with cattle manure at either 37C or 55C with and without the addition |
Species | |
Start position on genome | 158540 |
End posion on genome | 158625 |
Amino Acid | Leu |
Anticodon | TAA |
Upstream region at tRNA start position |
gcacaagcat |
tRNA gene sequence |
GCGGGGGTAGTCAAGCTGGACAACGGCGCGGGACTTAAGATCCCGTCCTTAGTGGTTCAT |
Downstream region at tRNA end position |
tttttcgttc |
Secondary structure (Cloverleaf model) | >WENV170719853 Leu TAA t ACCA tttttcgttc G - C C - G G - C G - C G - C G - C G - C T A T T A C C C A T C G A A | | | | | G G A C T G A T G G G C G | + | T T A C G G C C A A G TCCTTAGTGGTTC C - G G - C G - C G - C A - T C A T G T A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |