Sequence ID | >WENV170719854 |
Genome ID | LSQX01131132 |
Phylum/Class | [LSQX] anaerobic digester metagenome; 4 biogas reactors fed with cattle manure at either 37C or 55C with and without the addition |
Species | |
Start position on genome | 92534 |
End posion on genome | 92461 |
Amino Acid | Val |
Anticodon | GAC |
Upstream region at tRNA start position |
gaaccgcaat |
tRNA gene sequence |
GGGCTCATGGTCTAGTGGCTATGACGTCTCCCTGACACGGAGGAGGTCGCCGGTTCGAAT |
Downstream region at tRNA end position |
acttatctct |
Secondary structure (Cloverleaf model) | >WENV170719854 Val GAC t ACtc acttatctct G - C G - C G - C C - G T - A C - G A - T T A T C G G C C A T G A G | | | | | G G T C T G G C C G G C G | | | T T C T G A C T A G AGGTC T + G C - G T - A C - G C - G C C T A G A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |