Sequence ID | >WENV170719869 |
Genome ID | LSQX01131968 |
Phylum/Class | [LSQX] anaerobic digester metagenome; 4 biogas reactors fed with cattle manure at either 37C or 55C with and without the addition |
Species | |
Start position on genome | 2950 |
End posion on genome | 3021 |
Amino Acid | Cys |
Anticodon | GCA |
Upstream region at tRNA start position |
gagacgccac |
tRNA gene sequence |
GGTGGAATGGCCGAGTGGTGAGGCAACGGTCTGCAAAACCGTGCACACGGGTTCGATTCC |
Downstream region at tRNA end position |
gtcaggatct |
Secondary structure (Cloverleaf model) | >WENV170719869 Cys GCA c TCtg gtcaggatct G - C G - C T - A G - C G - C A - T A - T T T T T G C C C A G A G | | | | | G T G C C G A C G G G C G | | | T T G A G G C T G A GCAC A - T C - G G - C G - C T - A C A T A G C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |