Sequence ID | >WENV170719870 |
Genome ID | LSQX01131968 |
Phylum/Class | [LSQX] anaerobic digester metagenome; 4 biogas reactors fed with cattle manure at either 37C or 55C with and without the addition |
Species | |
Start position on genome | 3045 |
End posion on genome | 3119 |
Amino Acid | Val |
Anticodon | GAC |
Upstream region at tRNA start position |
tctgacccaa |
tRNA gene sequence |
GCGCGTTTAGCTCAGCGGGAGAGCGCTTCCCTGACACGGAAGAGGTCACTGGTTCAATCC |
Downstream region at tRNA end position |
agaccctcgg |
Secondary structure (Cloverleaf model) | >WENV170719870 Val GAC a ACCA agaccctcgg G - C C - G G - C C - G G - C T T T - A C T T T G A C C A G A A | | | | | A C C T C G A C T G G C G | | | | T T G G A G C G A G AGGTC C - G T - A T - A C - G C - G C C T A G A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |