Sequence ID | >WENV170719893 |
Genome ID | LSQX01132924 |
Phylum/Class | [LSQX] anaerobic digester metagenome; 4 biogas reactors fed with cattle manure at either 37C or 55C with and without the addition |
Species | |
Start position on genome | 75702 |
End posion on genome | 75776 |
Amino Acid | Thr |
Anticodon | GGT |
Upstream region at tRNA start position |
accgccagag |
tRNA gene sequence |
GCCGCTGTGGCTAAGGGGTATAGCGACGCCTTGGTAAGGCGTAGGTCGAGGGTTCAATTC |
Downstream region at tRNA end position |
cttctcattc |
Secondary structure (Cloverleaf model) | >WENV170719893 Thr GGT g TCCA cttctcattc G - C C - G C - G G - C C - G T - A G - C T T T C C C C C A G A G | | | | A G A T C G G A G G G C G | | | | T T G T A G C T A G AGGTC A - T C - G G - C C - G C - G T A T A G G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |