Sequence ID | >WENV170719904 |
Genome ID | LSQX01133135 |
Phylum/Class | [LSQX] anaerobic digester metagenome; 4 biogas reactors fed with cattle manure at either 37C or 55C with and without the addition |
Species | |
Start position on genome | 82026 |
End posion on genome | 82113 |
Amino Acid | Ser |
Anticodon | TGA |
Upstream region at tRNA start position |
tgcccattgc |
tRNA gene sequence |
GGAGGACTGGCCGAGTGGTCGATGGCGGCTGACTTGAAATCAGTTGAGGTGCAAGCCTCC |
Downstream region at tRNA end position |
ttttagaaat |
Secondary structure (Cloverleaf model) | >WENV170719904 Ser TGA c GCCA ttttagaaat G - C G - C A - T G - C G - C A - T C - G T A T T C T C C A T G A G | | + | | G G G C C G A G G G G C G + | | | T T T T G G C C G A G TGAGGTGCAAGCCTCC G + T C - G T - A G - C A - T C A T A T G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |