Sequence ID | >WENV170719917 |
Genome ID | LSQX01133735 |
Phylum/Class | [LSQX] anaerobic digester metagenome; 4 biogas reactors fed with cattle manure at either 37C or 55C with and without the addition |
Species | |
Start position on genome | 16799 |
End posion on genome | 16870 |
Amino Acid | Gly |
Anticodon | CCC |
Upstream region at tRNA start position |
agaaccaatc |
tRNA gene sequence |
GCGGGAGTAATTCAGCGGTAGAATGTCAGCTTCCCAAGCTGACCGTCGCCGGTTCGCTCC |
Downstream region at tRNA end position |
cattttaggg |
Secondary structure (Cloverleaf model) | >WENV170719917 Gly CCC c Ttat cattttaggg G - C C - G G - C G - C G - C A - T G - C C T T T G G C C C G A A + | | | | G C C T T A G C C G G C G | | | | T T G G A A T T A G CCGTC T - A C - G A - T G - C C - G T A T A C C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |