Sequence ID | >WENV170720373 |
Genome ID | LSQX01150974 |
Phylum/Class | [LSQX] anaerobic digester metagenome; 4 biogas reactors fed with cattle manure at either 37C or 55C with and without the addition |
Species | |
Start position on genome | 339 |
End posion on genome | 252 |
Amino Acid | Ser |
Anticodon | TGA |
Upstream region at tRNA start position |
attatataaa |
tRNA gene sequence |
GGAGAAATGGCAGAGTGGTCGATTGCGGCAGTCTTGAAAACTGTTGACTGTAACAGGTCC |
Downstream region at tRNA end position |
ctttctgaaa |
Secondary structure (Cloverleaf model) | >WENV170720373 Ser TGA a GCCT ctttctgaaa G - C G - C A - T G - C A - T A - T A - T T A T C T C C C A T G A G | + | | | G G G A C G G G G G G C G + | | | T T T T T G C C G A G TGACTGTAACAGGTCC G + T C - G A - T G - C T - A C A T A T G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |