Sequence ID | >WENV170720465 |
Genome ID | LSQX01153731 |
Phylum/Class | [LSQX] anaerobic digester metagenome; 4 biogas reactors fed with cattle manure at either 37C or 55C with and without the addition |
Species | |
Start position on genome | 56152 |
End posion on genome | 56078 |
Amino Acid | Asn |
Anticodon | GTT |
Upstream region at tRNA start position |
ggtttattat |
tRNA gene sequence |
TCCTCAGTAGCTCAACGGTGGAGCACTCGGCTGTTAACCGATAGGTTGTTGGTTCGAATC |
Downstream region at tRNA end position |
tttttttgca |
Secondary structure (Cloverleaf model) | >WENV170720465 Asn GTT t GCCA tttttttgca T - A C - G C - G T + G C - G A - T G - C T A T C A A C C A A A A | | | | | G C C T C G G T T G G C G | | | | T T G G A G C T G A AGGTT C T T - A C - G G - C G - C C A T A G T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |