Sequence ID | >WENV170720466 |
Genome ID | LSQX01153731 |
Phylum/Class | [LSQX] anaerobic digester metagenome; 4 biogas reactors fed with cattle manure at either 37C or 55C with and without the addition |
Species | |
Start position on genome | 43729 |
End posion on genome | 43638 |
Amino Acid | Ser |
Anticodon | GCT |
Upstream region at tRNA start position |
tgacgacagt |
tRNA gene sequence |
GGAGAAGTACTCAAGTGGCTATAAGAGGTACCCCTGCTAAGGGTATAGGCCGTTTACGCG |
Downstream region at tRNA end position |
tgatttgaac |
Secondary structure (Cloverleaf model) | >WENV170720466 Ser GCT t GCCA tgatttgaac G - C G - C A - T G - C A - T A - T G - C T A T C T C C C A G T G A A | | | | | A G A C T C G A G G G C C | | | T T T A G A G A T A G TAGGCCGTTTACGCGGTGC T - A A - T C - G C - G C - G C A T A G C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |