Sequence ID | >WENV170720467 |
Genome ID | LSQX01153859 |
Phylum/Class | [LSQX] anaerobic digester metagenome; 4 biogas reactors fed with cattle manure at either 37C or 55C with and without the addition |
Species | |
Start position on genome | 17298 |
End posion on genome | 17385 |
Amino Acid | Ser |
Anticodon | TGA |
Upstream region at tRNA start position |
aacgttgtcc |
tRNA gene sequence |
GGAGAGCTGTCCGAGTGGTCTATGGTGACTGACTTGAAATCAGTTGGGTGTCACAGCCCC |
Downstream region at tRNA end position |
ggctttattc |
Secondary structure (Cloverleaf model) | >WENV170720467 Ser TGA c GCCA ggctttattc G - C G - C A - T G - C A - T G - C C - G T A T T C T C C A T G A G | | + | | G G G C C T A G G G G C G + | | T T T T G G T C T A G TGGGTGTCACAGCCCC A - T C - G T - A G - C A - T C A T A T G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |