Sequence ID | >WENV170720563 |
Genome ID | LSQX01157667 |
Phylum/Class | [LSQX] anaerobic digester metagenome; 4 biogas reactors fed with cattle manure at either 37C or 55C with and without the addition |
Species | |
Start position on genome | 2973 |
End posion on genome | 2888 |
Amino Acid | Ser |
Anticodon | GGA |
Upstream region at tRNA start position |
cccacaacac |
tRNA gene sequence |
GGAGAGGTGACCGAGTGGTTTAAGGTGCACGCCTGGAACGCGTGTGTACGCAAGTACCGT |
Downstream region at tRNA end position |
tcataaaaaa |
Secondary structure (Cloverleaf model) | >WENV170720563 Ser GGA c GCCA tcataaaaaa G - C G - C A - T G - C A - T G + T G - C T A T C A C T C A T G A G | | | | | G G G C C A G T G A G C G | | | T T T A G G T T T A G TGTACGCAAGTACC C - G A - T C - G G - C C - G C C T A G G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |