Sequence ID | >WENV170720684 |
Genome ID | LSQX01162450 |
Phylum/Class | [LSQX] anaerobic digester metagenome; 4 biogas reactors fed with cattle manure at either 37C or 55C with and without the addition |
Species | |
Start position on genome | 29432 |
End posion on genome | 29506 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
aacaatatat |
tRNA gene sequence |
TGCGGGGTGGAGCAGAGGTAGCTCGTTGGGCTCATAACCCAAAGGCCGTAGGTTCGAATC |
Downstream region at tRNA end position |
aaagagcctg |
Secondary structure (Cloverleaf model) | >WENV170720684 Met CAT t ACTA aaagagcctg T T G - C C - G G - C G - C G - C G - C T A T C G T C C A G A G | + | | | G A C G A G G T A G G C G | | | | T T G G C T C T A G AGGCC T - A T - A G - C G - C G - C C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |