Sequence ID | >WENV170720729 |
Genome ID | LSQX01164193 |
Phylum/Class | [LSQX] anaerobic digester metagenome; 4 biogas reactors fed with cattle manure at either 37C or 55C with and without the addition |
Species | |
Start position on genome | 997 |
End posion on genome | 1084 |
Amino Acid | Ser |
Anticodon | GGA |
Upstream region at tRNA start position |
tcttcgacgc |
tRNA gene sequence |
GGAGGATTCGCCTAGCGGCCTATGGCGCTCGCCTGGAACGCGAGTTGGGAGCAATCCCTC |
Downstream region at tRNA end position |
aagagaaccc |
Secondary structure (Cloverleaf model) | >WENV170720729 Ser GGA c GCCA aagagaaccc G - C G - C A - T G - C G - C A - T T - A T A T T C C C C A C G A C | | | | | A G T C C G A G G G G C G | | | T T C T G G C C T A G TTGGGAGCAATCCCTC C - G T - A C - G G - C C - G C C T A G G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |