Sequence ID | >WENV170720752 |
Genome ID | LSQX01164775 |
Phylum/Class | [LSQX] anaerobic digester metagenome; 4 biogas reactors fed with cattle manure at either 37C or 55C with and without the addition |
Species | |
Start position on genome | 12406 |
End posion on genome | 12332 |
Amino Acid | Val |
Anticodon | GAC |
Upstream region at tRNA start position |
tcatctcgtt |
tRNA gene sequence |
GGGCGATTAGTTCAGAGGTAGAACGCTTCCTTGACACGGAAGAGGTCAGAAGTTCAATTC |
Downstream region at tRNA end position |
tagtcgtaaa |
Secondary structure (Cloverleaf model) | >WENV170720752 Val GAC t ACCA tagtcgtaaa G - C G - C G - C C - G G - C A - T T - A T T T T C T T C A G A A | | | | | A A C T T G A G A A G C G | | | | T T G G A A C T A G AGGTC C - G T - A T - A C - G C - G T C T A G A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |