Sequence ID | >WENV170720877 |
Genome ID | LSQX01170084 |
Phylum/Class | [LSQX] anaerobic digester metagenome; 4 biogas reactors fed with cattle manure at either 37C or 55C with and without the addition |
Species | |
Start position on genome | 1644 |
End posion on genome | 1729 |
Amino Acid | Ser |
Anticodon | GGA |
Upstream region at tRNA start position |
tagtttttaT |
tRNA gene sequence |
GCTGAGGTAGTCTAGCGGTAGGGCGCGGGCCTGGAAAGCCCGTGAGGCGAAAGTCTCTCG |
Downstream region at tRNA end position |
ttgttttaga |
Secondary structure (Cloverleaf model) | >WENV170720877 Ser GGA T GTtc ttgttttaga G - C C - G T - A G - C A - T G - C G - C T A T C C C T C A G A A | | | | | A C T C T G G G G A G C G + | + | T T G G G G C T A G TGAGGCGAAAGTCTCTC C - G G - C G - C G - C C - G C A T A G G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |