Sequence ID | >WENV170720973 |
Genome ID | LSQX01173503 |
Phylum/Class | [LSQX] anaerobic digester metagenome; 4 biogas reactors fed with cattle manure at either 37C or 55C with and without the addition |
Species | |
Start position on genome | 17407 |
End posion on genome | 17480 |
Amino Acid | Gly |
Anticodon | CCC |
Upstream region at tRNA start position |
actcatttat |
tRNA gene sequence |
GCGGGTGTAACTCAATGGTAGAGTGCCAGCTTCCCAAGCTGGTTACGTGGGTTCGATTCC |
Downstream region at tRNA end position |
tgagcccact |
Secondary structure (Cloverleaf model) | >WENV170720973 Gly CCC t TCCA tgagcccact G - C C - G G - C G - C G - C T - A G - C T T T T A C C C A A A A + | | | | G T C T C A G T G G G C G | | | | T T G G A G T T A G TTAC C - G C - G A - T G - C C - G T A T A C C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |