Sequence ID | >WENV170720975 |
Genome ID | LSQX01173651 |
Phylum/Class | [LSQX] anaerobic digester metagenome; 4 biogas reactors fed with cattle manure at either 37C or 55C with and without the addition |
Species | |
Start position on genome | 17369 |
End posion on genome | 17454 |
Amino Acid | Ser |
Anticodon | TGA |
Upstream region at tRNA start position |
ccacgctcat |
tRNA gene sequence |
GGAGGGATGGCCGAGTGGTTTAAGGCGGCGGTCTTGAAAACCGTTGTGCGAAAGTACCGT |
Downstream region at tRNA end position |
gaaacccgag |
Secondary structure (Cloverleaf model) | >WENV170720975 Ser TGA t GCCA gaaacccgag G - C G - C A - T G - C G - C G - C A - T T A T C A T C C A T G A G | | + | | G G G C C G G T G G G C G | | | T T T A G G C T T A G TGTGCGAAAGTACC G + T C - G G - C G - C T - A C A T A T G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |