Sequence ID | >WENV170720976 |
Genome ID | LSQX01173651 |
Phylum/Class | [LSQX] anaerobic digester metagenome; 4 biogas reactors fed with cattle manure at either 37C or 55C with and without the addition |
Species | |
Start position on genome | 17477 |
End posion on genome | 17569 |
Amino Acid | Ser |
Anticodon | GCT |
Upstream region at tRNA start position |
tgccttgaaa |
tRNA gene sequence |
GGAGAGATGACCGAGTAGGCCGATGGTGCTCGCCTGCTAAGCGAGTGTGGGGGTTATACT |
Downstream region at tRNA end position |
tatagaaaaa |
Secondary structure (Cloverleaf model) | >WENV170720976 Ser GCT a GCCA tatagaaaaa G - C G - C A - T G - C A - T G - C A - T T A T C T C C C A A T G A G | | | | | G G G C C A G A G G G C G + | | | T T C T G G T C G A G TGTGGGGGTTATACTCCACC C - G T - A C - G G - C C - G C A T A G C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |