Sequence ID | >WENV170721009 |
Genome ID | LSQX01175751 |
Phylum/Class | [LSQX] anaerobic digester metagenome; 4 biogas reactors fed with cattle manure at either 37C or 55C with and without the addition |
Species | |
Start position on genome | 2844 |
End posion on genome | 2770 |
Amino Acid | Gln |
Anticodon | TTG |
Upstream region at tRNA start position |
cggttcttct |
tRNA gene sequence |
TGGGGTATCGCCAAGCGGTAAGGCAACGGTTTTTGGTACCGTCATTCGAAGGTTCGAATC |
Downstream region at tRNA end position |
cttttaaatc |
Secondary structure (Cloverleaf model) | >WENV170721009 Gln TTG t TCCA cttttaaatc T - A G - C G - C G - C G - C T - A A - T T A T C T T C C A G A C | | | | | G C A C C G G A A G G C G | | | T T G A G G C T A A CATTC A - T C - G G - C G - C T - A T T T G T T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |