Sequence ID | >WENV170721145 |
Genome ID | LSQX01181012 |
Phylum/Class | [LSQX] anaerobic digester metagenome; 4 biogas reactors fed with cattle manure at either 37C or 55C with and without the addition |
Species | |
Start position on genome | 250 |
End posion on genome | 334 |
Amino Acid | Tyr |
Anticodon | GTA |
Upstream region at tRNA start position |
agttttatac |
tRNA gene sequence |
GGAGGGATACCCAAGTGGCCAAAGGGGGCAGACTGTAAATCTGTTGTCACTGACTTCGAT |
Downstream region at tRNA end position |
ataaaaaaac |
Secondary structure (Cloverleaf model) | >WENV170721145 Tyr GTA c ACCA ataaaaaaac G - C G - C A - T G - C G - C G - C A - T T A T C T A C C A T G A A | | | | | G G A C C C G A T G G C G | | | T T C A G G G C A A G TGTCACTGACTTC G + T C - G A - T G - C A - T C A T A G T A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |