Sequence ID | >WENV170721153 |
Genome ID | LSQX01181297 |
Phylum/Class | [LSQX] anaerobic digester metagenome; 4 biogas reactors fed with cattle manure at either 37C or 55C with and without the addition |
Species | |
Start position on genome | 25422 |
End posion on genome | 25493 |
Amino Acid | Gly |
Anticodon | CCC |
Upstream region at tRNA start position |
atgagcgact |
tRNA gene sequence |
GCCGGCGTAGTTTAATGGTAGAACTGCAGCTTCCCAAGCTGCTGGCGCGGGTTCGATTCC |
Downstream region at tRNA end position |
tctgaaaatg |
Secondary structure (Cloverleaf model) | >WENV170721153 Gly CCC t TCgg tctgaaaatg G - C C - G C - G G - C G - C C - G G - C T T T T G C C C A A A A + | | | | G T T T T G G C G G G C G + | | | T T G G A A C T A T TGGC G - C C - G A - T G - C C - G T A T A C C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |