Sequence ID | >WENV170721237 |
Genome ID | LSQX01182909 |
Phylum/Class | [LSQX] anaerobic digester metagenome; 4 biogas reactors fed with cattle manure at either 37C or 55C with and without the addition |
Species | |
Start position on genome | 56228 |
End posion on genome | 56142 |
Amino Acid | Ser |
Anticodon | GGA |
Upstream region at tRNA start position |
gagccaccag |
tRNA gene sequence |
GCCGAGGTGGCCCAGACCGGTAAGGCGCAAGCCTGGAAAGCTTGTGTCCGCAAGGACTCG |
Downstream region at tRNA end position |
tcctttttac |
Secondary structure (Cloverleaf model) | >WENV170721237 Ser GGA g GCCA tcctttttac G - C C - G C - G G - C A - T G - C G - C T A T C A C T C A A G A G | | | | | A C C C C G G T G A G C C | | | T T G A G G C G T A G TGTCCGCAAGGACTC C - G A - T A - T G - C C - G C A T A G G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |