Sequence ID | >WENV170721276 |
Genome ID | LSQX01184439 |
Phylum/Class | [LSQX] anaerobic digester metagenome; 4 biogas reactors fed with cattle manure at either 37C or 55C with and without the addition |
Species | |
Start position on genome | 3383 |
End posion on genome | 3313 |
Amino Acid | Gly |
Anticodon | TCC |
Upstream region at tRNA start position |
ttgtgcattc |
tRNA gene sequence |
GCATCGATGGTCTAGTGGTATGACTTTGGCCTTCCAAGCCAATAGCCCGGGTTCAATTCC |
Downstream region at tRNA end position |
ggctcgtggt |
Secondary structure (Cloverleaf model) | >WENV170721276 Gly TCC c Atgg ggctcgtggt G - C C - G A - T T - A C - G G - C A - T T T T G G C C C A G A G | | | | | A T T C T G C C G G G C G | | | T T G T G A C T A T TAGC T - A T - A G - C G - C C - G C A T A T C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |