Sequence ID | >WENV170721302 |
Genome ID | LSQX01185061 |
Phylum/Class | [LSQX] anaerobic digester metagenome; 4 biogas reactors fed with cattle manure at either 37C or 55C with and without the addition |
Species | |
Start position on genome | 56890 |
End posion on genome | 56802 |
Amino Acid | Ser |
Anticodon | TGA |
Upstream region at tRNA start position |
gccgccataa |
tRNA gene sequence |
GCCGAGGTAGCAAAGCCCGGATCACCGCGCCAGCCTTGAGAGCTGGTGTCCGCAAGGACT |
Downstream region at tRNA end position |
catacttcct |
Secondary structure (Cloverleaf model) | >WENV170721302 Ser TGA a GCCT catacttcct G - C C - G C - G G - C A - T G - C G - C T A T C C C T C A C C G A A | | | | | G C A A C G G G G A G C G | | T T G C C G C A T C A G TGTCCGCAAGGACTC C - G C - G A - T G - C C - G C A T G T G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |