Sequence ID | >WENV170721303 |
Genome ID | LSQX01185061 |
Search identical group | |
Phylum/Class | [LSQX] anaerobic digester metagenome; 4 biogas reactors fed with cattle manure at either 37C or 55C with and without the addition |
Species | |
Start position on genome | 15870 |
End posion on genome | 15797 |
Amino Acid | Ala |
Anticodon | CGC |
Upstream region at tRNA start position |
cgattcgcaa |
tRNA gene sequence |
GGGCAGATAGATCAGCTGGAAGATCGCGACATTCGCAATGTCGAGGCCGCGGGTTCAAAT |
Downstream region at tRNA end position |
aaactctggc |
Secondary structure (Cloverleaf model) | >WENV170721303 Ala CGC a ACtc aaactctggc G - C G - C G + T C - G A - T G - C A - T T A T C G C C C A C G A A | | | | | A T C T A G G C G G G C G | | | | T T G G A T C A A G AGGCC C - G G - C A - T C - G A - T T A T A C G C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |