Sequence ID | >WENV170721349 |
Genome ID | LSQX01186940 |
Phylum/Class | [LSQX] anaerobic digester metagenome; 4 biogas reactors fed with cattle manure at either 37C or 55C with and without the addition |
Species | |
Start position on genome | 38060 |
End posion on genome | 38133 |
Amino Acid | Trp |
Anticodon | CCA |
Upstream region at tRNA start position |
tctgttttct |
tRNA gene sequence |
GGGGGTATAGTTCAAAGGTAGAGCAACGGTCTCCAAAACCGTTAATGTGGGTTCGAGTCC |
Downstream region at tRNA end position |
taaagcctga |
Secondary structure (Cloverleaf model) | >WENV170721349 Trp CCA t GCCA taaagcctga G + T G - C G - C G - C G - C T - A A - T T G T C G T C C A A A A | + + | | G A C T T G G T G G G C G | | + | T T G G A G C T A A TAAT A - T C - G G - C G - C T - A C A T A C C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |