| Sequence ID | >WENV170721480 |
| Genome ID | LSQX01192236 |
| Phylum/Class | [LSQX] anaerobic digester metagenome; 4 biogas reactors fed with cattle manure at either 37C or 55C with and without the addition |
| Species | |
| Start position on genome | 58887 |
| End posion on genome | 58972 |
| Amino Acid | Leu |
| Anticodon | CAA |
| Upstream region at tRNA start position |
attcgtacgT |
| tRNA gene sequence |
GGTCGAGTGGTGGAATTGGCATACACGCGGGACTCAAAATCCCGTGCTAGCAATAGCGTG |
| Downstream region at tRNA end position |
attaatactt |
| Secondary structure (Cloverleaf model) | >WENV170721480 Leu CAA
T ATat attaatactt
G - C
G - C
T - A
C - G
G - C
A - T
G - C T C
T C T C C C A
T A A G | | | | | A
T G G T G G A G G G C
G | | | T T
G A C A C
C A T G TGCTAGCAATAGCGT
C - G
G - C
G - C
G - C
A - T
C A
T A
C A A
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |