Sequence ID | >WENV170721480 |
Genome ID | LSQX01192236 |
Phylum/Class | [LSQX] anaerobic digester metagenome; 4 biogas reactors fed with cattle manure at either 37C or 55C with and without the addition |
Species | |
Start position on genome | 58887 |
End posion on genome | 58972 |
Amino Acid | Leu |
Anticodon | CAA |
Upstream region at tRNA start position |
attcgtacgT |
tRNA gene sequence |
GGTCGAGTGGTGGAATTGGCATACACGCGGGACTCAAAATCCCGTGCTAGCAATAGCGTG |
Downstream region at tRNA end position |
attaatactt |
Secondary structure (Cloverleaf model) | >WENV170721480 Leu CAA T ATat attaatactt G - C G - C T - A C - G G - C A - T G - C T C T C T C C C A T A A G | | | | | A T G G T G G A G G G C G | | | T T G A C A C C A T G TGCTAGCAATAGCGT C - G G - C G - C G - C A - T C A T A C A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |