Sequence ID | >WENV170721509 |
Genome ID | LSQX01193538 |
Phylum/Class | [LSQX] anaerobic digester metagenome; 4 biogas reactors fed with cattle manure at either 37C or 55C with and without the addition |
Species | |
Start position on genome | 1139 |
End posion on genome | 1226 |
Amino Acid | Ser |
Anticodon | TGA |
Upstream region at tRNA start position |
gtagaagcga |
tRNA gene sequence |
GCCGGGATAGTCTAGTCCGGTAAGGCGGTGGCCTTGAAAGCCACTGGTGCCTGGCACCTC |
Downstream region at tRNA end position |
catcttctgt |
Secondary structure (Cloverleaf model) | >WENV170721509 Ser TGA a GCTA catcttctgt G - C C - G C - G G - C G - C G - C A - T T A T C C C T C A T G A A | | | | | A C T C T G G G G A G C C | | + | T T G A G G C G T A G TGGTGCCTGGCACCTC G - C T - A G - C G - C C - G C A T A T G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |