Sequence ID | >WENV170721789 |
Genome ID | LSQX01203645 |
Phylum/Class | [LSQX] anaerobic digester metagenome; 4 biogas reactors fed with cattle manure at either 37C or 55C with and without the addition |
Species | |
Start position on genome | 167548 |
End posion on genome | 167622 |
Amino Acid | Gly |
Anticodon | GCC |
Upstream region at tRNA start position |
accacttggt |
tRNA gene sequence |
GCGGACGTGGCTCAGCGGTAGAGCATCGCCTTGCCAAGGCGAGGGTCGCGGGTTCAAATC |
Downstream region at tRNA end position |
tttctatctt |
Secondary structure (Cloverleaf model) | >WENV170721789 Gly GCC t TCCA tttctatctt G - C C - G G - C G - C A - T C - G G - C T A T T G C C C A G A G + | | | | A C C T C G G C G G G C G | | | | T T G G A G C T A A GGGTC T - A C - G G - C C - G C - G T A T A G C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |