Sequence ID | >WENV170721831 |
Genome ID | LSQX01205180 |
Phylum/Class | [LSQX] anaerobic digester metagenome; 4 biogas reactors fed with cattle manure at either 37C or 55C with and without the addition |
Species | |
Start position on genome | 22438 |
End posion on genome | 22352 |
Amino Acid | Ser |
Anticodon | TGA |
Upstream region at tRNA start position |
gtctttttaT |
tRNA gene sequence |
GGAGAGATGTCCGAGCGGTCGAAGGAGGCGGTCTTGAAAACCGTTGAGGCGCAAGTCTCC |
Downstream region at tRNA end position |
tggacaacgt |
Secondary structure (Cloverleaf model) | >WENV170721831 Ser TGA T GGat tggacaacgt G - C G - C A - T G - C A - T G - C A - T T A T C C C C C A C G A G | | | | G G G C C T G A G G G C G | | | T T T A G G A C G A G TGAGGCGCAAGTCTCC G + T C - G G - C G - C T - A C A T A T G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |