Sequence ID | >WENV170721833 |
Genome ID | LSQX01205180 |
Phylum/Class | [LSQX] anaerobic digester metagenome; 4 biogas reactors fed with cattle manure at either 37C or 55C with and without the addition |
Species | |
Start position on genome | 22051 |
End posion on genome | 21964 |
Amino Acid | Ser |
Anticodon | CGA |
Upstream region at tRNA start position |
ataatcaccg |
tRNA gene sequence |
GGAGAGATGTCCGAGTGGTCGAAGGAGACGGACTCGAAATCCGTTGTACCGTCTGACGGT |
Downstream region at tRNA end position |
gcttggttat |
Secondary structure (Cloverleaf model) | >WENV170721833 Ser CGA g Gata gcttggttat G - C G - C A - T G - C A - T G - C A - T T A T C T C C C A T G A G | | | | | G G G C C T G A G G G C G | | | T T T A G G A C G A G TGTACCGTCTGACGGTACC A - T C - G G - C G - C A - T C A T A C G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |