Sequence ID | >WENV170721834 |
Genome ID | LSQX01205180 |
Phylum/Class | [LSQX] anaerobic digester metagenome; 4 biogas reactors fed with cattle manure at either 37C or 55C with and without the addition |
Species | |
Start position on genome | 21919 |
End posion on genome | 21833 |
Amino Acid | Ser |
Anticodon | GGA |
Upstream region at tRNA start position |
attgtacctT |
tRNA gene sequence |
GGAGAGGTGTCCGAGTGGTCGATGGTGCACGCTTGGAAAGCGTGTGTGCTGAAAGGCACC |
Downstream region at tRNA end position |
tcttcccagt |
Secondary structure (Cloverleaf model) | >WENV170721834 Ser GGA T GTtt tcttcccagt G - C G - C A - T G - C A - T G + T G - C T A T C C C C C A T G A G | | | | | G G G C C T G G G G G C G + | | T T T T G G T C G A G TGTGCTGAAAGGCACC C - G A - T C - G G - C C - G T A T A G G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |