Sequence ID | >WENV170721872 |
Genome ID | LSQX01207018 |
Phylum/Class | [LSQX] anaerobic digester metagenome; 4 biogas reactors fed with cattle manure at either 37C or 55C with and without the addition |
Species | |
Start position on genome | 23462 |
End posion on genome | 23387 |
Amino Acid | Lys |
Anticodon | CTT |
Upstream region at tRNA start position |
cccgctccac |
tRNA gene sequence |
GCGCCTTTAGCTCAGTTGGTAGAGCACCTGACTCTTAATCAGGGTGTCCCGGGTTCGAGT |
Downstream region at tRNA end position |
caatgaatgt |
Secondary structure (Cloverleaf model) | >WENV170721872 Lys CTT c ACCA caatgaatgt G - C C - G G - C C - G C - G T - A T - A T G T G T C C C A T G A A | | | | G T C T C G C C G G G C G | | | | T T G G A G C T A A GTGTC C - G C - G T - A G - C A - T C A T A C T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |