Sequence ID | >WENV170721962 |
Genome ID | LSQX01211047 |
Phylum/Class | [LSQX] anaerobic digester metagenome; 4 biogas reactors fed with cattle manure at either 37C or 55C with and without the addition |
Species | |
Start position on genome | 2472 |
End posion on genome | 2384 |
Amino Acid | Ser |
Anticodon | GGA |
Upstream region at tRNA start position |
atctccgccg |
tRNA gene sequence |
GGAGAGATGCTCGAGAGGCTGAAGAGGCACGCCTGGAAAGCGTGTATACGCCAAAAGTGT |
Downstream region at tRNA end position |
agaacatttg |
Secondary structure (Cloverleaf model) | >WENV170721962 Ser GGA g GCag agaacatttg G - C G - C A - T G - C A - T G - C A - T T A T C G C C C A A G A G | | | | | G G G C T C G C G G G C G | | | T T C A G A G T G A G TATACGCCAAAAGTGTATC C - G A - T C - G G - C C - G C A T A G G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |