Sequence ID | >WENV170722068 |
Genome ID | LSQX01215152 |
Phylum/Class | [LSQX] anaerobic digester metagenome; 4 biogas reactors fed with cattle manure at either 37C or 55C with and without the addition |
Species | |
Start position on genome | 2010 |
End posion on genome | 2099 |
Amino Acid | Ser |
Anticodon | GCT |
Upstream region at tRNA start position |
aacaaaaaac |
tRNA gene sequence |
GGACAGTTGGGTGAGTGGCTGAAACCACCTCCCTGCTAAGGAGACGTACTGGCAACGGTA |
Downstream region at tRNA end position |
tttgtgggtc |
Secondary structure (Cloverleaf model) | >WENV170722068 Ser GCT c GCCA tttgtgggtc G - C G - C A - T C - G A - T G - C T - A T A T C T C C C A T G A G | | | | | A G G T G G G A G G G C G | | | T T C A A C C T G A A CGTACTGGCAACGGTACC C A C - G T - A C - G C - G C A T A G C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |