Sequence ID | >WENV170722084 |
Genome ID | LSQX01215547 |
Phylum/Class | [LSQX] anaerobic digester metagenome; 4 biogas reactors fed with cattle manure at either 37C or 55C with and without the addition |
Species | |
Start position on genome | 41535 |
End posion on genome | 41610 |
Amino Acid | Val |
Anticodon | TAC |
Upstream region at tRNA start position |
cacaccgcac |
tRNA gene sequence |
GGGCTCATGGTCTAGCGGTTATGACGTTGCCCTTACACGGCGAAGACCGCCGGTTCGAAT |
Downstream region at tRNA end position |
catccttttt |
Secondary structure (Cloverleaf model) | >WENV170722084 Val TAC c ACCA catccttttt G - C G - C G - C C - G T - A C - G A - T T A T C G G C C A C G A G | | | | | G G T C T G G C C G G C G | | | T T T T G A C T A G AGACC T - A T + G G - C C - G C - G C C T A T A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |